INTRODUCTION:

Pigments are natural dyes produce by microorganisms used in various industries for food, pharmaceutical, textile and cosmetic applications. Fermentation is widely used method for the production of secondary metabolites, pigments, enzymes, peptides, growth factors etc from the microorganisms for the industrial applications. There are two fermentation methods which have been developed for the production of natural products such as solid state fermentation (SSF), submerged fermentation (SmF).

The development of these two fermentation methods has increased the production of bioactive compounds used in different industries such as pharmaceuticals, food, probiotics and prebiotics. The different natural products produced by using fermentation techniques are antibiotics, pigments, antioxidants, enzymes, biosurfactants, hypercholestroleromic agents, antihypertensive agents, antitumor agents, and bioactive peptides.¹ Microorganisms are potential source of natural pigments that can be used in food industry.^2,3 Natural pigments have desirable properties like water soluble, stability to light, heat, pH, contain pro-vitamin A and have anticancer activity.⁴ The industrial production of pigments using microbial fermentation has several advantages because of its cheap and easier extraction and high pigment yield. The food industry uses microbial technology for pigment production. Filamentous fungi have been used for the production of different natural products, such as enzymes, antibiotics, colorants, additives and many others which are used in cosmetic, food and pharmaceutical applications.⁵ The natural products derived from plant and animal source exhibit some disadvantages such as low solubility and instability. ⁶ On the other hand due to the environmental and toxicity issues of synthetic pigments industries are looking for microorganisms for the alternative source of natural compounds. ^6,7 The fungal members of Fusarium, Monascus, Aspergillus, Penicillium and Chaetomium species are reported to produce high pigment production both intracellular and extracellular pigments with different colours ranging from red, yellow, orange.^8-14

Most of these fungal strains are non-pathogenic and non-mycotoxigenic to humans. Fungi produce different types of enzymes and secondary metabolites with various activities to survive and compete with the environment.

Chaetomium cupreum produces extracellular, water soluble pigments into its fermentation broth called azaphilones. Chaetomium species produce coloured secondary metabolites called azaphilones. Azaphilones are fungal secondary metabolites or polyketide derivatives, known as pigments with pyrone-quinone structures containing oxygenated bicyclical core and a chiral quaternary centre.^15,16 Azaphilones have property of reacting with amino group of different molecules such as DNA, RNA, peptides, amino acids for exchange of pyrane oxygen for nitrogen to form red or purple vinylogous gamma-pyridones and become water-soluble pigments.¹⁷ Azaphilones exhibit a wide range of interesting biological activities such as antimicrobial, antifungal, antiviral, antioxidant, cytotoxic, nematicidal and anti-inflammatory activities. The potent biological activities of azaphilones are due to the formation of vinylogous gamma-pyridones.¹⁸ with this background, present study was designed to evaluate the pigment production, extraction method, biomass estimation and phytochemical screening of extracellular biopigments from C. cupreum through submerged fermentation.

MATERIALS AND METHODS:

Isolation of Chaetomium cupreum

The isolation of fungus C. cupreum was carried out from litter soil sample collected from the GKVK campus, Bangalore, Karnataka, India. 50 mg of soil sample was dissolved in 5 ml of distilled water in a test tube. Then, 1 ml of soil sample was spread onto the potato dextrose agar (PDA) medium and incubated at room temperature. After incubation growth of number of different fungal colonies were observed, from which pigment producing colony was transferred to a new potato dextrose agar (PDA) medium plates and incubated at room temperature at 28 °C for 3 to four days.¹⁹

Identification of fungus Chaetomium cupreum

The pure pigment producing fungus was identified based on morphological and microscopic characteristics.²⁰ The morphological identity of C. cupreum was confirmed by National Fungal Culture Collection of India (NFCCI), by Agharkar Research Institute, Pune, India. The molecular technique based on the molecular phylogenetics of the internal transcribed spacer (ITS) region gene sequencing, using universal primers, ITS-1 (TCCGTAGGTGAACCTGCGG) was the forward primer and ITS-4 TCCTCCGCTTATTGATATGC) was the reverse primer was performed.²¹ In Gene Bank homologous sequences search was performed using BLAST (National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/ blast).²² The BLAST search for ITS sequence analysis available in Gen bank showed 99% homology with other strains of C. cupreum. The sequence was deposited in NCBI Gen bank with accession Number KF668034. The culture was assigned with accession Number (NFCCI 3117) and was deposited in the National Fungal Culture Collection of India (NFCCI).

Cultural morphology

Chaetomium cupreum was cultured on potato dextrose agar plates and incubated for 7 days at 28 ± 2°C at room temperature. After 7 days of incubation, morphological studies were carried by microscopic observation by using lactophenol Cotton Blue Stain for studying fungus mycelium, hyphae, and pigmentation on the PDA medium.

Fungus maintenance and cultural media

The isolated fungus was maintained on potato dextrose agar (PDA) plates and potato dextrose agar slants at 4°C. For pigments production potato dextrose broth (PDB) medium was used at 28 ± 2°C at pH 6.

Inoculum preparation and submerged fermentation (SmF)

Chaetomium cupreum strain was used for the production of pigments. For inoculum preparation, the fungus was grown at 28 ± 2°C on a PDA plate for 7 days, then 5 mm mycelial discs were bored out from the periphery of the colony and transferred to 250 ml Erlenmeyer flasks containing 100 ml of potato dextrose broth (PDB, pH 6) and incubated at 28 ± 2°C on a rotary shaker at 120 rpm for 20 days to achieve the highest pigment production.^23-25

Extraction of extracellular pigments

The extraction of pigments was carried out according to the method described by Lathadevi et al.²⁶ After 20 days of incubation biomass was removed by filtration through Whatman No. 1 filter paper and the broth containing the extracellular pigment/metabolites was obtained. The cultural broth obtained was used for extraction of pigments/compounds by liquid-liquid method in 500 ml of separating funnel using four different solvents from non-polar to polar (chloroform, ethyl acetate, n-butanol and methanol) in the ratio of 1:1. The 50 ml of filtered broth and 50 ml of solvent was taken in separating funnel and shaken well for 20 minutes and allowed to stand until the aqueous layer and organic layers separated. The organic layer was collected, filtered through Whatman No. 1 filter paper and transferred to 250 ml of beaker. This process was repeated three times with the same broth and same solvent until no more pigment diffused into the solvent. The whole broth was extracted by using similar procedure with chloroform, ethyl acetate, n-butanol and methanol. Then organic layer was evaporated using vacuum rotary evaporator at 45 °C. The crude dried extract was obtained and stored at 4°C for future use.

Determination of pigment and biomass estimation

The mycelium after 20 days of incubation at 28 ± 2°C at room temperature was separated from fermentation broth by filtration through Whatman No. 1 filter paper. The separated mycelial was washed thrice with distilled water and then air-dried at room temperature. The dry weight of the mycelium and the crude extract produced was estimated. The biomass concentration was expressed as mycelial dry weight (g/l).²⁷

Phytochemical Screening of Chaetomium cupreum

The fungus C. cupreum extracts were screened for the presence of different phytochemicals by standard procedure (28,29). The stock concentration was made 10 mg of fungal extract was dissolved in 10 ml solvent to make the sample for preliminary phytochemicals tests.

Test for Alkaloids

Dragendroff’s test. A volume of 0.5 ml fungal extract was added to 2 ml of hydrochloric acid (Hcl). Then 1 ml of Dragendroff’s reagent was added. An orange red precipitate produced indicates the presence of alkaloids.

Mayor’s test. A volume of 1.2 ml the fungal extract was taken in a test tube, 0.2 ml of 1% aqueous hydrochloric acid (HCI) was added and kept in water bath and 0.1 ml Mayer’s reagents (Potassium Mercuric Iodide) were added. Formation of yellow colored precipitate confirmed the presence of alkaloid.

Test for Flavonoid

Alkaline reagent test. To 1 ml of the fungal extract in test tube, a few drops of diluted sodium hydroxide (NAOH) were added. The flavonoids presence is indicated by the yellow colour formation in sample extract and later turns colourless on addition of a few drops of diluted acid indicates the presence of

Shinoda test. To 4 ml of fungal extract 1.5 ml of 50% methanol solution is added. The solution was warmed and metal magnesium is added. Few drops of 5-6 concentrated hydrochloric acid (HCL) is added, flavonoids will appear red in colour and flavones as orange in colour

Test for Carbohydrates

Molisch’s test. A small quantity of the fungal extract was dissolved separately in 4 ml of distilled water and filtered and 2 ml of concentrated H₂SO₄ and 2 to 3 drops of 1% alcoholic α-naphthol solution and 2 ml of concentratedsulphuric acid was added. The presence of carbohydrates is indicated by brown ring formation at the junction of two liquids.

Test for Glycosides

Legal’s Test. The fungal extract was hydrolyzed with few drops Hcl on a water bath and this hydrolysate, 1 ml of pyridine and few drops of sodium nitroprusside solution were added and then it was made alkaline solution with sodium hydroxide. Appearance of pink red colour indicates the presence of glycosides.

Test for Saponins

Foam test. To 1 ml fungal extract, 2 ml of distilled water was added and shaken well. Persistent foam formation indicates presence of saponins.

Lead acetate test. A volume of 1 ml fungal extract was treated with 1% lead acetate solution. Formation of white precipitate indicates the presence of saponins.

Test for Tannins

Ferric chloride test. To 0.5 ml of fungal extract, 1 ml of water was added in a test tube and filtered. Then few drops of 0.1% ferric chloride was added and observed for brownish green or blue black coloration.

Lead acetate test. In a test tube containing about 5.0 ml of the fungal extract a few drops of 1%lead acetate was added. The formation of yellow precipitate indicates the presence of tannins.

Potassium dichromate test. A volume of 5 ml of the fungal extract was treated with 1 ml of 10% aqueous potassium dichromate solution. The formation of yellowish brown precipitate indicates the presence of tannins.

Test for Phytosterol

Salkowski test: A volume of 10 mg fungal extract was dissolved in 1 ml of solvent used; 1 ml of concentrated H₂SO₄ was then added carefully along the sides of the test tube. The red colour indicating the presence of sterols.

Test for phenolic compounds

Folin- Ciocaltaeu’s test: A volume of 10 mg fungal extract was dissolved in 1ml of solvent used. Add 1 ml of diluted Folin-Ciocaltaeu’s reagent (1:1) to the mixture. The formation of the blue colour indicates the presence of phenolic compounds.

Test for terpenoids

Salkowki’s test. 1 ml of solvent was added to 2 ml of fungal extract followed by a few drops of concentrated sulphuric acid. A reddish brown precipitate produced indicates the presence of terpenoids.

Coumarins

Sodium hydroxide. Add 3 ml of 10% NaOH to 2 ml of fungal extract, formation of yellow colour indicates the presence of coumarins.

RESULTS:

Isolation and Identification of fungus

The isolated fungus was identified as C. cupreum by NFCCI, Agharkar Research Institute, Pune, India. Species identification was done by molecular phylogenetics of the ITS-5.8S region of the rDNA. BLAST search performed for the sequence of ITS analysis, showed 99% homology with other strains of C. cupreum available in Gen bank. The sequence was deposited in NCBI Genbank with accession number KF668034. Thus, based on morphological, microscopic and molecular characters the fungus was named as C. cupreum SS02.

Cultural Morphology

Chaetomium cupreum exhibited typical white cottony colonies on the PDA. The fungus C. cupreum produces red pigment around the colony onto PDA plates and indicates that it is water soluble pigments. The morphology of the fungus was studied after 7 days of incubation on PDA plates. The microscopic observation of lactophenol cotton blue stained slides shows perithecia with ascospores and hairs (asci) (Fig. 1).

Table No1. Phytochemical analysis of C. cupreum extract

S.No	Phytochemical Constituents	Phytochemical Tests	Chloroform extract	Ethyl acetate extract	n-butanol extract	Methanol extract
1	Alkaloids	Dragendroffs test	-	-	-	-
1	Alkaloids	Mayers test	-	-	-	-
2	Test for flavonoids	Alkaline reagent test	+	+	+	+
3	Test for carbohydrates	Molischs test	-	+	-	+
4	Test for glycosides	Legals test	-	+	+	-
5	Test for saponins	Foam test	+	+	+	+
5	Test for saponins	Lead acetate test	+	+	+	+
6	Test for tannins	Ferric chloride test	-	+	+	+
		Lead acetate test	+	+	+	+
		Potassium dichromate test	+	+	+	-
7	Test for phytosterol	Salkowski tesst	-	+	-	-
8	Test for phenolic compounds	Follin ciocalteau test	+	+	-	+
9	Test for terpenoids	Salkowki test	+	-	+	+
10	Coumarins	NaOH test	-	+	+	-

(-Absent, +Present)

DISCUSSION:

Pigments are substances which are being widely used in food, cloth, painting, cosmetics, pharmaceuticals and plastics industries.³⁰ Pigments are capable of absorbing light in the visible range (400–700 nm). Natural products such as isoprenoids, alkaloids and flavonoids have been used as colorants, flavours and fragrances. On the other hand, in food, cosmetics and pharmaceutical industries, due to the serious environment problems, adverse toxicological side effects, safety problems and harmful issues associated with the workers of industry as well as consumer caused by many artificial synthetic pigments, research is now focused on the production of safe and natural pigments from natural resources. Thus, there is worldwide interest for the development and production of pigments and colours from natural sources.³¹ The natural pigments from plants also have drawbacks such as instability against light, heat or adverse pH, low water solubility and are often non-availability throughout the year. Similarly in contrast to higher plants, fungi are more suitable for biotechnological production of pigments because of their fast growth rate, easier culture techniques, ability to grow on cheap substrates, independent of weather conditions, production of different shades of colours, high yield of the products and the feasibility of bioprocess development.³² There is an inadequate research studies available on the pigment production by microorganisms such as fungi. As compared to animals and plants, microorganisms such as fungi and bacteria produce high yield during fermentation process with stable pigments such as rubramines, quinones, carotenoids, flavonoids.³³ Biopigments are natural and a better alternative to synthetic chemical pigments which are used in industries and laboratories.³⁴ The biopigments or microbial pigments are naturally coloured compounds produced by microorganisms, especially fungi and bacteria. The pigment producing microorganisms are fungi, bacteria, yeast, algae. Among the pigment molecules produced by microorganisms are azaphilones, carotenoids, melanins, quinines, monascins etc. The extracellular pigment producing organisms are C. cupreum which produces reddish purple pigment, Mycelium sterilia produces deep orange pigments and species of Trichoderma. Penicillium., Aspergillus, Alternaria also produce extracellular pigments. A number of microorganisms are known to produce of carotenoids (yellow to orange red pigment). Natural pigments or microbial pigments not only have the capacity to increase the marketability of product in various foods processing and cosmetics industries but they also display advantageous biological activities as antioxidative, anticancerous, antiproliferative, immunosuppressive, antibiotic and biodegradability.³⁵ These microbial pigments have broad area of application, mainly in food industries, pharmaceutical industries and textile industries. Some pigments such as β-carotene, arpink Red, riboflavin and lycopene are used in food industries. Smoe pigments such as anthocyanin, prodigiosin and violacein are useful in the treatment of diseases.

The PDB medium contains nutrients such as metal ions and other micronutrients useful for the enzymes to work effectively and increase the metabolite and pigment production.^36,37 Submerged fermentation produces high mycelial production and thus higher pigment production in shorter time.^38,39 The culture of edible mushrooms produces high pigment production through submerged fermentation.^40,39 The C. cupreum showed the maximum pigment production in PDB medium through submerged fermentation. Submerged fermentation (SmF) is easy to operate with low cast, shorter cultivation time and high pigment production.^41,42 In submerged fermentation, batch and continuous mode techniques can be used to produce high pigment production.⁴³

The maximum product yield was found in methanol extract, followed by ethyl acetate extract whereas least yield was found in chloroform extract of C. cupreum. Submerged fermentation involves the cultivation of selected microorganisms in the fermentation broth such as potato dextrose broth. Screening of C. cupreum reveals that the maximum classes of phytochemicals are present C. cupreum extracts. The presence of these phytochemicals indicates the potential of C. cupreum extracts in various biological applications. C. cupreum extracts contain tannins which are useful in healing of wounds and inflamed mucous membranes. Flavonoids, terpenoids and saponins were also found in C. cupreum. Flavonoids acts as a potent water-soluble antioxidant and prevent oxidative cell damage^44,45 and important for managing diabetes induced oxidative stress. Terpenoids also possess various biological properties such as antimicrobial, antifungal, antiparasitic, antiviral, anti-allergenic, antispasmodic, antihyperglycemic, antiinflammatory and immunomodulatory properties.^46,47 In agriculture, terpenoids are used as insecticidal protective substances for storing agriculture products.⁴⁸ Saponins have precipitating and coagulating properties for red blood cells.^49,50 The C cupreum extracts also contain carbohydrates, glycosides and coumarins which are known to be useful for immune system by increasing body strength. Coumarins have antimicrobial and anti-inflammatory properties and are useful in hyperproliferative skin diseases.⁵¹ The C. cupreum extracts contain glycosides and are known to posess various therapeutic properties. Phytochemicals are used in pharmaceutical applications due to their various biological properties such as antioxidant⁵², antibacterial ⁵³, antifungal⁵⁴, antidiabetic^55,56, anti-inflammatory⁵⁷, radio-protective activity.⁵⁸ Thus, from the present investigation medicinal properties of the C. cupreum can be identified based on the phytochemicals present in it.

The soil isolated fungus C. cupreum have shown significant pigments production through submerged fermentation and its phytochemical analysis revealed that C. cupreum contains different types of compounds that can be used in the food and pharmaceutical industry after their purification and characterization.

ACKNOWLEDGMENT:

The authors are grateful to UGC (University Grants Commission), New Delhi, Govt. of India, for UGC-MRP Grants for financial support and also to the Head, Department of Microbiology and Biotechnology (MB and BT), Bangalore University, Bengaluru (BUB), Karnataka, India, for the use of laboratory facilities.

AUTHOR CONTRIBUTIONS:

NAW carried out all the assays, analysis, and interpretation of results and wrote the initial manuscript. ST was responsible for the idea of research and interpretation of the results and edited the manuscript.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE:

Not applicable for this submission.

CONFLICTS OF INTEREST:

The authors declare no conflict of interest

REFERENCES:

1. Subramaniyam R. and Vimala R. Solid state and submerged fermentation for the production of bioactive substances: a comparative study. International Journal of science and Nature. 2012; 3: 480-486.

2. Aberoumand A. A Review Article on Edible Pigments Properties and Sources as Natural Biocolorants in Foodstuff and Food Industry. World Journals of Dairy and Food Sciences. 2011; 6: 71-78.

3. Ahmad et al. Application of Bacterial Pigments as Colorant. Springer Briefs in Molecular Science. 2012; 57-74.

4. Joshi et al. Microbial Pigments, Indian Journal of Biotechnology. 2003; 2: 362-369.

5. Ferreira et al. Waste biorefineries using filamentous ascomycetes fungi: present status and future prospects. Bioresource and Technology. 2016; 215: 334-45.

6. Gunasekaran S and Poorniammal R. Optimization of fermentation conditions for red pigment production from Penicillium sp. under submerged cultivation. African Journal of Biotechnology. 2008; 7: 1894-1898.

7. Dufosse et al. Microorganisms and microalgae as sources of pigments for food use: A scientific oddity or an industrial reality. Trends in Food Science and Technology. 2005; 16: 389- 406.

8. Blanc et al. Pigments of Monascus. Journals of Food Science. 1994; 59: 862-865.

9. Tseng et al. Growth, pigment production and protease activity of Monascus purpureus as affected by salt, sodium nitrite, polyphosphate and various sugars. Journals of Applied Microbiology. 2000; 88: 31-37.

10. Carvalho et al. Production of Monascus biopigments: an overview. Agro Food Industries Hi-Tech. 2003; 14: 37-42.

11. Engstrom et al. Spectral identification, X-ray structure determination, and iron chelating capability of erythroglaucin, a red pigment from Aspergillus ruber, Journals of Agriculture and Food Chemistry. 1982; 30: 304-307.

12. Mendez et al. Fungal production of a red pigment using a xerophilic strain of Penicillium purpurogenum GH2, Rev. Mex. Ing. Quím. 2007; 6: 267-273.

13. Mapari et al. Exploring fungal biodiversity for the production of water soluble pigments as potential natural food colorants. Current and Opinion Biotechnology. 2005; 16: 231-238.

14. Yilmaz et al. Delimitation and characterization of Talaromyces purpurogenus and related species. Persoonia. 2012; 29: 39-54.

15. Strudikova, M. Mikrobialna produkcia farbnych azaphilonovych metabolitov. Chemistry Listy. 2000; 94: 105-110.

16. Dong J. New nematicidal azaphilones from the aquatic fungus Pseudohalonectria adversaria. Microbiol Letters. 2006; 264, 65-79.

17. Stadler M. Novel Bioactive Azaphilones from Fruit Bodies and Mycelial Cultures of the Ascomycete Bulgaria inquinans (Fr.). Natural Production Letters. 1995; 7: 7-14.

18. Park. Antifungal activity against plant pathogenic fungi of chaetoviridins isolated from Chaetomium globosum. FEMS microbiology letters. 2005; 252: 309-313.

19. Osmanova. Azaphilones: a class of fungal metabolites with diverse biological activities. Phytochemistry review. 2010; 9: 315-342.

20. Charu et al. Pigment production from trichoderma spp. for dyeing of silk and wool. International journal of science and nature. 2013; 4: 351-355.

21. Kim et al. Molecular and Morphological Identification of Fungal Species Isolated from Rice Meju. Food Science and Biotechnology. 2013; 22: 721-728.

22. White et al. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: a Guide to Methods and Applications. 1990; 315–322.

23. Altschul et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Research. 1997; 25: 3389–3402.

24. Morales et al. Quantitative assessment of the impact of the type of inoculum on the kinetics of cell growth, substrate consumption and pigment productivity by Penicillium purpurogenum GH2 in liquid culture with an integrated stochastic approach. Food Bioproduction and Process. 2015; 96: 221–231.

25. Morales et al. Selection of best conditions of inoculum preparation for optimum performance of the pigment production process by Talaromyces spp. using the Taguchi method. Biotechnology Programme (2017).

26. Lathadevi et al. Pigment production from a mangrove penicillium, African Journal of Biotechnology. 2014; 13: 2668-2674.

27. Olsson L, and Nielsen J. Online and in situ monitoring of biomass in submerged cultivations. Trends in biotechnology. 1997; 15: 517-522.

28. Harbone JB. Phytochemical methods. London: Chapman and Hall. Ltd. 1973; 49-188.

29. Sofowora A. Medicinal plants and Traditional medicine in Africa: Spectrum Books Ltd, Ibadan, Ibadan, Nigeria. 1993; 289.

30. Yuan et al. Production of violet pigment by a newly isolated psychrotrophic bacterium from a glacier in Xinjiang, China. Biochemistry Engineering Journal. 2009; 43: 135-141.

31. Unagul et al. Production of red pigment by the insect pathogenic fungus Cordyceps unilateralis BBC 1869. Journals of Industrial Microbiology and Biotechnology. 2005; 32: 135-140.

32. Zhao et al. Studies on the properties of a microbial blue pigment. Food Fermentation and Industry. 1998; 5: 21-24.

33. Duran et al. Ecological-friendly pigments from fungi. Crit. ReV. Food Science and Nutrition. 2002; 42 (1): 53-66.

34. Palanichamy et al. Optimization of cultivation parameters for growth and pigment Production by streptomyces spp. isolated from marine sediment and rhizosphere soil. International journal of Plant, Animal and Environmental science. 2011; 1: 158-170.

35. Kang et al. Effect of pH and nonionic surfactant on component profile of intracellular and extracellular Monascus pigments. Process of Biochemistry. 2013; 48: 759–67.

36. Boonyapranai et al. Optimization of submerged culture for the production of naphthoquinones pigment by Fusarium verticillioides. Chiang Mai Journal of Science. 2008; 35: 457–466.

37. Premalatha et al. Production and characterization of naphthoquinone pigment from Fusarium moniliforme MTCC6985. World Journal of Pharm Research. 2012; 1: 1126–1142.

38. Cho et al. Production of red pigment by submerged culture of Paecilomyces sinclairii. Letters in Applied Microbiology. 2002; 35: 195–202.

39. Kim et al. Influence of nutrition conditions on the mycelial growth and exopolysaccharide production in Paecilomyces sinclairii. Letters of Applied Microbiology. 2002; 34: 389-393.

40. Park et al. Optimization of submerged culture conditions for the mycelial growth and exo-biopolymer production by Cordyceps militaris. Letters of Applied Microbiology. 2001; 32: 1-6.

41. Feng et al. Monascus pigments. Applied Microbiology and Biotechnology. 2012; 96: 1421-40.

42. Evans PJ and Wang HY. Pigment production from immobilized Monascus sp. utilizing polymeric resin adsorption. Applied Journals of Environmental Microbiology. 1984; 47: 1323-1326.

43. Torres et al. Natural colorants from filamentous fungi, Applied Microbiology and Biotechnology. 2016; 100: 2511-21.

44. Venil CK. and Lakshmanaperumalsamy P. An insightful overview on microbial pigment, prodigiosin, Elect. Journals of Biology. 2009; 5: 49-61.

45. Rio et al. Uses and properties of citrus flavonoids. Journals of Agriculture and Food Chemistry. 1997; 45: 4505-4515.

46. Salah et al. Polyphenolic flavonoids as scavenger of aqueous phase radicals as chain breaking antioxidant. Archives of Biochemistry and Biophysics. 1995; 2: 339-46.

47. Rabi T and Bishayee A. Terpenoids and breast cancer chemoprevention. Breast Cancer Research Treatment. 2009; 115: 223-239.

48. Wagner KH and Elmadfa I. Biological relevance of terpenoids: Overview focusing on mono-di and tetraterpenes. Annmals of Nutrition and Metabolism. 2003; 47: 95-106.

49. Sultana N and Ata A. Oleanolic acid and related derivatives as medicinally important compounds. Journals of Enzyme Inhibition and Medical Chemistry. 2008; 23: 739-756.

50. Okwu DE. Phytochemicals and vitamin content of indigenous spices of southeastern Nigeria. Journals of Sustainable Agricuture and Environment. 2004; 6: 30-37.

51. Sodipo et al. Studies on certain characteristics of extracts of bark of Pansinystalia macruceras (K schemp) Pierre Exbeille. Global Journals of Pure and Applied Science. 2000; 6: 83-87.

52. Theis N and Lerdau M. The evolution of function in plant secondary metabolites. International Journal of Plant Science. 2003; 164: S93-S103.

53. Wong et al. Antioxidant properties of Hibiscus species variation, altitudinal change costal influence and floral colour change. Journal of Tropical Forest Science. 2009; 21: 307-315.

54. Nair et al. Antibacterial activity of some selected Indian medicinal flora. Turkey Journal of Biology. 2005; 29: 41-47.

55. Khan M and Wassilew SW. Natural pesticides from the neem tree and other tropical plants. (Eds) Schmutterer H and Asher KRS. Digitalverlag GmbH. Germany. 1987; 645-650.

56. Singh N and Gupta M. Effect of ethanolic extract of Syzygium cumini seed powder on pancreatic islets of alloxen diabetic rats. Industrial Journal of Experimental Biology. 2007; 45: 861-867.

57. Kumar et al. Anti diabetic activity of Syzygium cumini seed and its isolate compounds against streptozotocin induced diabetic rats. Journal of Medicine Plant Research. 2008a; 2: 246-249.

58. Kumar et al. Anti inflammatory activity of Syzigium cumini seed. African Journal of Biotechnology. 2008b; 7: 941-943.

59. Jagetia et al. Influence of seed extracts of S. cumini on mice exposed to different doses of γ radiation. Journal of Radiation Research. 2005; 46: 59-65.

Received on 16.11.2017 Modified on 20.12.2017

Res. J. Pharmacognosy and Phytochem. 2018; 10(1): 15-22.

DOI: 10.5958/0975-4385.2018.00003.1